pK7WGF2::hCas9
Growth in Bacteria
- Bacterial Resistance(s): Spectinomycin
- Growth Temperature: 37°C
- Growth Strain(s): DH5alpha
- Copy number: Low Copy
Backbone
- Vector backbone: pK7WGF2
- Backbone size w/o insert (bp) 10257
- Total vector size (bp) 14397
- Vector type: CRISPR ; Plant expression
- Selectable markers: Kanamycin
Purpose
Expesses the human codon usage Cas9 nuclease (Mali et al. Science 339, 823-826, 2013) with an N-terminal GFP tag from the 35S promoter in the plant tissue
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAGGCTCCGCGGCCGC
- 3′ sequencing primer TTGTACAAGAAAGCTGGGTCG
Gene/Insert
- Gene/Insert name: hCas9
- Species: Synthetic
- Insert Size (bp): 4140
- Promoter 35S
- Tag / Fusion Protein
- eGFP (N terminal on insert)