pK7WGF2::hCas9
Growth in Bacteria
  1. Bacterial Resistance(s): Spectinomycin
  2. Growth Temperature: 37°C
  3. Growth Strain(s): DH5alpha
  4. Copy number: Low Copy
Backbone
  1. Vector backbone: pK7WGF2
  2. Backbone size w/o insert (bp) 10257
  3. Total vector size (bp) 14397
  4. Vector type: CRISPR ; Plant expression
  5. Selectable markers: Kanamycin
Purpose
Expesses the human codon usage Cas9 nuclease (Mali et al. Science 339, 823-826, 2013) with an N-terminal GFP tag from the 35S promoter in the plant tissue
Cloning Information
  1. Cloning method Gateway Cloning
  2. 5′ sequencing primer CAGGCTCCGCGGCCGC
  3. 3′ sequencing primer TTGTACAAGAAAGCTGGGTCG
Gene/Insert
  1. Gene/Insert name: hCas9
  2. Species: Synthetic
  3. Insert Size (bp): 4140
  4. Promoter 35S
  5. Tag / Fusion Protein
  6. eGFP (N terminal on insert)
Slider